Advertisement

Addition of an adipose marker to the organ tissue identification mRNA assay

Published:September 24, 2022DOI:https://doi.org/10.1016/j.fsigss.2022.09.012

      Abstract

      At the Netherlands Forensic Institute, mRNA profiling for the purpose of organ tissue identification is frequently requested in casework. The previous version of the assay (denoted Organtyper) lacked markers for identifying adipose tissue, while this was occasionally questioned in casework. Here, three potential adipose markers are examined before incorporating one into the final Organtyper assay. The added value of the adipose marker becomes clear from looking at casework results.

      Keywords

      1. Introduction

      At the NFI, mRNA profiling is frequently used in casework for the identification of body fluids and organ tissues [
      • Lindenbergh A.
      • van den Berge M.
      • Oostra R.J.
      • et al.
      Development of a mRNA profiling multiplex for the inference of organ tissues.
      ,
      • van den Berge M.
      • Bhoelai B.
      • Harteveld J.
      • et al.
      Advancing forensic RNA typing: on non-target secretions, a nasal mucosa marker, a differential co-extraction protocol and the sensitivity of DNA and RNA profiling.
      ]. Organ tissue identification is performed using the Organtyper assay [
      • Lindenbergh A.
      • van den Berge M.
      • Oostra R.J.
      • et al.
      Development of a mRNA profiling multiplex for the inference of organ tissues.
      ] and is often requested in violent cases, for example when knives or bullets are involved or when spatters of tissue-like structures are found on e.g. clothing of a suspect. Occasionally, these tissue-like substances have an adipose-like appearance but the previously published version of the Organtyper assay [
      • Lindenbergh A.
      • van den Berge M.
      • Oostra R.J.
      • et al.
      Development of a mRNA profiling multiplex for the inference of organ tissues.
      ] only contained mRNA makers for brain, lung, liver, skeletal muscle, heart and kidney tissue and lacked markers for adipose. In order to identify adipose tissue, three potential adipose markers (SCD, ADIPOQ and TRARG1) were examined. After assessing the specificity of the markers on a range of organ tissues and the performance on different adipose donors, one marker (TRARG1) was added to the Organtyper assay that is currently used in casework.

      2. Material and methods

      Genes (SCD, ADIPOQ and TRARG1) were selected using literature and gene expression database BioGPS [
      • Hanson E.
      • Ballantyne J.
      Human organ tissue identification by targeted RNA deep sequencing to aid the investigation of traumatic injury.
      ,
      • Wu C.
      • Jin X.
      • Tsueng G.
      • et al.
      BioGPS: building your own mash-up of gene annotations and expression profiles.
      ]. Primers were designed using Ensembl and NCBI Primer Blast [
      • Flicek P.
      • Amode M.R.
      • Barrell D.
      • et al.
      Ensembl 2014.
      ,
      • Ye J.
      • Coulouris G.
      • Zaretskaya I.
      • et al.
      Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction.
      ]. DNA/RNA co-extraction, DNase treatment, reverse transcription, PCR and CE were performed according to standardized protocols [
      • Lindenbergh A.
      • van den Berge M.
      • Oostra R.J.
      • et al.
      Development of a mRNA profiling multiplex for the inference of organ tissues.
      ].
      Adipose-specificity of the three genes was assessed using the FirstChoice® Human Total RNA Survey Panel (Applied Biosystems), which are pools of total RNA for 20 different human tissues including adipose and the six organs targeted by the Organtyper assay [
      • Lindenbergh A.
      • van den Berge M.
      • Oostra R.J.
      • et al.
      Development of a mRNA profiling multiplex for the inference of organ tissues.
      ]. For each tissue, an input of 10 pg RNA was used during PCR, which is the input for which the Organtyper assay was developed and optimized [
      • Lindenbergh A.
      • van den Berge M.
      • Oostra R.J.
      • et al.
      Development of a mRNA profiling multiplex for the inference of organ tissues.
      ].
      Performance of the marker on its target tissue was assessed by testing adipose tissue of different donors. The adipose samples were collected from the upper arm of ten deceased donors who consented to scientific use of their body.

      3. Results and discussion

      Primer concentrations were optimized using adipose tissue RNA extract of five donors. The optimized primer concentrations were 0.05, 0.1 and 0.1 µM for ADIPOQ, SCD and TRARG1, respectively (results not shown).
      All three primer sets were included in the Organtyper assay [
      • Lindenbergh A.
      • van den Berge M.
      • Oostra R.J.
      • et al.
      Development of a mRNA profiling multiplex for the inference of organ tissues.
      ] using their optimized primer concentrations. Specificity of the three markers to adipose tissue was assessed on the 20 organ tissues of the FirstChoice RNA Survey, including adipose tissue. An overview of the results of these specificity tests is shown in Table 1. All three potential adipose markers were detected in adipose tissue. Non-specific signals were detected for markers SCD and ADIPOQ in respectively 12 and 3 out of the 19 tested non-adipose tissues. SCD and ADIPOQ were therefore omitted from further testing. Specificity of TRARG1 was confirmed as it was only detected in adipose tissue and not in any of the other tissues. False positive signals for other markers in the Organtyper assay (lung marker SFTPB and skeletal muscle markers MYH1 and TNNI2) are in line with previous results [
      • van den Berge M.
      • Sijen T.
      Extended specificity studies of mRNA assays used to infer human organ tissues and body fluids.
      ].
      Table 1Specificity results for the adipose markers in the Organtyper assay. Signals in target tissues are presented in green. Signals in non-target tissues are shown in grey. General muscle marker NMRK2
      • Lindenbergh A.
      • van den Berge M.
      • Oostra R.J.
      • et al.
      Development of a mRNA profiling multiplex for the inference of organ tissues.
      results are not included; this marker has been omitted from the Organtyper assay due to limited value in case work.
      The Organtyper assay was supplemented with only TRARG1 and performance of this marker on its target tissue was assessed by testing adipose tissues of different donors. TRARG1 was detected in all ten of the adipose tissues, showing that it can be used to detect adipose tissues in a range of different donors (results not shown). An overview of the final Organtyper assay, including TRARG1 is presented in Table 2.
      Table 2Primer information for all primers in the final Organtyper assay. Underlined nucleotides are 5′ tails added to improve multiplex spacing, CNS = central nervous system. FXYD2 has two forward primers to ensure amplification of different transcript variants. Primers from
      • Lindenbergh A.
      • van den Berge M.
      • Oostra R.J.
      • et al.
      Development of a mRNA profiling multiplex for the inference of organ tissues.
      are unmodified and are only included for completeness. The fluorescent dye is added to the forward primer unless stated otherwise.
      Gene[primer] (µM)TissueForward primer (5′ – 3′)Size (bp)DyeRef.
      Reverse primer (5′ – 3′)
      SNAP250.02CNSF: TCGGCGGCTCCACCACAGTT

      R: TTGGCTCTGGACCTGGGCTTCTC
      786FAM™
      • Lindenbergh A.
      • van den Berge M.
      • Oostra R.J.
      • et al.
      Development of a mRNA profiling multiplex for the inference of organ tissues.
      OPALIN0.8CNSF: GCCATGGAGGAAAGTGACAGACC

      R: CTCATGTGTGGGTGATCTCCTAGG
      936FAM™
      • Lindenbergh A.
      • van den Berge M.
      • Oostra R.J.
      • et al.
      Development of a mRNA profiling multiplex for the inference of organ tissues.
      GFAP0.04CNSF: TGGAGAGGAAGATTGAGTCGCTGG

      R: CGAACCTCCTCCTCGTGGATCTTC
      706FAM™
      • Lindenbergh A.
      • van den Berge M.
      • Oostra R.J.
      • et al.
      Development of a mRNA profiling multiplex for the inference of organ tissues.
      SFTPB0.LungF: CCATGATTCCCAAGGGTGCGCTA

      R: CGCCACCAGAGGTACCACGC
      68NED™
      • Lindenbergh A.
      • van den Berge M.
      • Oostra R.J.
      • et al.
      Development of a mRNA profiling multiplex for the inference of organ tissues.
      SFTPD0.10LungF: CCTGCCTGGTCGCGATGGAC

      R: CCAGGCATCCCTGCTTGCCC
      996FAM™
      • Lindenbergh A.
      • van den Berge M.
      • Oostra R.J.
      • et al.
      Development of a mRNA profiling multiplex for the inference of organ tissues.
      AMBP0.03LiverF: TTGGCTGACCGAGGTGAATGTGTCC

      R: ACCAGTTGCCCACCCCCTGAT
      119VIC™
      • Lindenbergh A.
      • van den Berge M.
      • Oostra R.J.
      • et al.
      Development of a mRNA profiling multiplex for the inference of organ tissues.
      VTN0.05LiverF: GTGCAAGCCCCAAGTGACTCG

      R: CATAGACCGTGTACTCATCCTCCG
      65VIC™
      • Lindenbergh A.
      • van den Berge M.
      • Oostra R.J.
      • et al.
      Development of a mRNA profiling multiplex for the inference of organ tissues.
      TNNI20.13Skeletal muscleF: ATGTCTGAAGTGCAGGAGCTCTGC

      R: GTCGTACTTCTCCTCTTCAGCCGC
      72PET™
      • Lindenbergh A.
      • van den Berge M.
      • Oostra R.J.
      • et al.
      Development of a mRNA profiling multiplex for the inference of organ tissues.
      MYH10.8Skeletal muscleF: TTCGCATCTCTACGCCAGGGTCCTTA

      R: AGGAAAGGAGCAGCCTCCCCAAA
      104NED™
      • Lindenbergh A.
      • van den Berge M.
      • Oostra R.J.
      • et al.
      Development of a mRNA profiling multiplex for the inference of organ tissues.
      MYL70.08HeartF: AAGCTCAATGGGACAGACCCCG

      R: CACCACCCCTTTGCCGCTGG
      82VIC™
      • Lindenbergh A.
      • van den Berge M.
      • Oostra R.J.
      • et al.
      Development of a mRNA profiling multiplex for the inference of organ tissues.
      MYBPC30.4HeartF: AGGCAGAGAAGGCAGAGCCCAT

      R: AGCTTGACCCTTTGGGACTTGGG
      129VIC™
      • Lindenbergh A.
      • van den Berge M.
      • Oostra R.J.
      • et al.
      Development of a mRNA profiling multiplex for the inference of organ tissues.
      UMOD0.06KidneyF: ATCACACGGAAAGGTGTCCAGGC

      R: TTTTTTGGAGCACAGGGCTTTCCGC
      1456FAM™
      • Lindenbergh A.
      • van den Berge M.
      • Oostra R.J.
      • et al.
      Development of a mRNA profiling multiplex for the inference of organ tissues.
      FXYD20.06KidneyF1: CTCTCCAAAAAGCAGAGACAGCAGG

      F2: CTCCATCCAGGCCCCAGGCA

      R: CGGTCTCATAGTCATAGTAGAACGGG
      137

      143
      PET™

      (rv)
      • Lindenbergh A.
      • van den Berge M.
      • Oostra R.J.
      • et al.
      Development of a mRNA profiling multiplex for the inference of organ tissues.
      TRARG10.1AdiposeF: TGGTGGCCGTGACCGTCAA

      R: GAGCTCTCCCGATGGCCAG
      95PET™This paper
      18S-rRNA0.013HousekeepingF: GACTCAACACGGGAAACCTCACC

      R: CTCCACCAACTAAGAACGGCCATG
      110PET™
      • Lindenbergh A.
      • van den Berge M.
      • Oostra R.J.
      • et al.
      Development of a mRNA profiling multiplex for the inference of organ tissues.

      4. Conclusion

      After assessing the specificity of the markers on a range of organ tissues and the performance on different adipose donors, TRARG1 was added to the Organtyper assay. The inclusion of this adipose marker is of added value especially in violent crimes, as adipose cells on violent objects may indicate perforation.
      The updated Organtyper assay has been applied in 27 cases on 78 forensic samples and adipose was detected in 13 of these samples. Five of these were knives, one was a tool, the remaining seven were either clothing or bed sheets.

      Conflict of interest

      None.

      Acknowledgements

      Francisca Duijs is thanked for critically reading the manuscript.

      References

        • Lindenbergh A.
        • van den Berge M.
        • Oostra R.J.
        • et al.
        Development of a mRNA profiling multiplex for the inference of organ tissues.
        Int. J. Leg. Med. 2013; 127: 891-900
        • van den Berge M.
        • Bhoelai B.
        • Harteveld J.
        • et al.
        Advancing forensic RNA typing: on non-target secretions, a nasal mucosa marker, a differential co-extraction protocol and the sensitivity of DNA and RNA profiling.
        Forensic Sci. Int.: Genet. 2016; 20: 119-129
        • Hanson E.
        • Ballantyne J.
        Human organ tissue identification by targeted RNA deep sequencing to aid the investigation of traumatic injury.
        Genes. 2017; 8: 319
        • Wu C.
        • Jin X.
        • Tsueng G.
        • et al.
        BioGPS: building your own mash-up of gene annotations and expression profiles.
        Nucleic Acids Res. 2016; 44: D313-D316
        • Flicek P.
        • Amode M.R.
        • Barrell D.
        • et al.
        Ensembl 2014.
        Nucleic Acids Res. 2014; 42: D749-D755
        • Ye J.
        • Coulouris G.
        • Zaretskaya I.
        • et al.
        Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction.
        BMC Bioinf. 2012; 13: 134
        • van den Berge M.
        • Sijen T.
        Extended specificity studies of mRNA assays used to infer human organ tissues and body fluids.
        Electrophoresis. 2017; 38: 3155-3160