Advertisement

Development of a new 17 Y-STRs system using fluorescent-labelled universal primers and its application in Shanxi population in China

Published:September 23, 2019DOI:https://doi.org/10.1016/j.fsigss.2019.09.037

      Highlights

      • A new 17 Y-STR system was developed for human identification and paternity testing.
      • Universial fluorescent-labeled primer was used to develop a panel, which amplicons range from 126bp to 400bp.
      • A population study with 394 unrelated individual from Shanxi Han of China was performed using this panel.

      Abstract

      Y-chromosomal short tandem repeats (Y-STRs) polymorphisms are useful in forensic identification, population genetics and constructing of human structures. Increasing the number of Y-STRs and their polymorphism will drastically narrow down the matching number of genealogy populations or pedigrees when searching against a forensic DNA databank. In this study, we develop a system containing 17 complementary Y-STRs that are compatible and reinforce the current commercially available Y-STR kits. This system was constructed by multiplex PCR with expected size of 126bp-400bp using home-made universal primers labeled by different fluorescence (DYS715, DYS709, DYS716, DYS713, DYS607, DYS718, DYS723, DYS708, DYS714, DYS712, DYS717, DYS721, DYS605, DYS719, DYS726, DYS598 and DYS722). The genetic data were obtained from 394 individuals in Shanxi province, China. The Y-STR system has 131 haplotypes and high discrimination power is 1. In conclusion, our study provides a robust, sensitive and cost-effective genotyping method for human identification, which is beneficial for narrowing the searching scope when applying to the genealogy searching with Y-STR DNA databank.

      Keywords

      1. Introduction

      With the rapid development of DNA analysis technology, STR genotyping methods containing multiplex PCR with fluorescently labeled primers and capillary electrophoresis, have been conventionally employed in the field of forensic medicine for individual identification and paternity testing [
      • Zhao Z.L.
      • Xia L.
      • Zhao C.
      • et al.
      Population genetics of 15 autosomal STR loci in the Han population of Ili Kazakh Autonomous Prefecture, Northwestern China.
      ]. The Y-chromosome acts as a unique tool for forensic investigations since it is inherited through the patrilineal line in a relatively conserved manner. A number of commercial Y-STR kits are available and most incorporate 19–36 markers into the single multiplex systems, which have been validated for casework [
      • Guan T.
      • Song X.
      • Xiao C.
      • et al.
      Analysis of 23 Y-STR loci in Chinese Jieyang Han population.
      ,
      • Gao H.M.
      • Wang C.
      • Han S.Y.
      • et al.
      Analysis of the 19 Y-STR and 16 X-STR loci system in the Han population of Shandong province, China.
      ]. Despite the robustness of these commercial multiplex Y-STR systems and the ability to discriminate two male individuals in most cases, the coincidence match probabilities are modest compared with a set of standard autosomal STR markers. Hence, there is still a need to develop new Y-STR markers to supplement these cases where additional discriminatory power is desired or where there is a coincidental Y-STR match between potential male participants.
      In this study, we developed a new 17 Y-STR typing kit, which exceeds the current Y-STR system containing the trinucleotide loci DYS718, DYS719, the tetranucleotide loci DYS715, DYS709, DYS713, DYS607, DYS708, DYS723, DYS712, DYS605, DYS726 and DYS722, the pentanucleotide loci DYS716, DYS714, DYS717, DYS721 and DYS598 [
      • Zhang G.Q.
      • Yang S.Y.
      • Niu L.L.
      • et al.
      Structure and polymorphism of 16 novel Y-STRs in Chinese Han population.
      ,
      • Zhang G.Q.
      • Wang Y.
      • Zhang Y.X.
      • et al.
      Study of polymorphism at new Y-STR DYS605 in a Chinese Han population of Shanxi.
      ,
      • Zhang G.Q.
      • Yun K.M.
      • Zhang Y.X.
      • et al.
      Allele frequencies for two new Y-chromosome STR loci DYS598 and DYS607 in Chinese Han population (Shanxi area).
      ]. We then developed a new kind of genotyping method using FAM/JOE/TAMRA/ROX-labeled universal M13 primers. With direct amplification and 4-dye fluorescence labeling M13 (−21) primer [
      • Oka K.
      • Asari M.
      • Omura T.
      • et al.
      Genotyping of 38 insertion/deletion polymorphisms for human identification using universal fluorescent PCR.
      ], this Y-STR kit was designed for personal identification and paternity testing.

      2. Material studied

      FTA blood samples were from 394 unrelated males in Taiyuan City (Shanxi Province) with the approval of the Ethics Committee of Shanxi Medical University. Written informed consent was obtained from all participants. The extraction and quantification process was performed as the manufacturer’s instruction.
      Sequences for each locus were obtained from NCBI using a standard nucleotide BLAST (Basic Local Alignment Search Tool) search. We selected 17 autosomal Y-STRs, which were classified into four sets (Sets A, B, C and D) based upon the needs of multiplex amplification.
      We used universal fluorescent PCR to detect the STRs. An 18-base universal M13 (−21) sequence (TGTAAAACGACGGCCAGT) was used as a standard sequence. The universal tail was added to the 5′ termini of the forward primers in each set. Primer-related information on each locus was listed in Table 1.
      Table 1General information on loci used in the new 17 Y-STR system.
      STR locusRepeat motifNo. allelesAmplicon size (bp)Primer sequencesPrimer concentrations (uM)99482800M
      SetA
      FAM-M13TGTAAAACGACGGCCAGT0.25
      DYS715(TAGA)m7125–149TGTAAAACGACGGCCAGTATGGTTGGAAGAAAGCATTGATGA0.041412
      CATCCATCCATCACATCTATATCATCTTTA0.04
      DYS709(TTCT)4CTCT(TTCT)2(CTTTTCT)2CTT(TTCT)m8175–199TGTAAAACGACGGCCAGTTCTTTCCAATGACCAAGACGTG0.0082025
      TGCAAATTGTTCACATGTACCCT0.075
      DYS716(CACTC)m(CATTC)n5227–247TGTAAAACGACGGCCAGTTAAATCAGAATTCCTTTCCAATCCA0.041516
      TCTGGGTTTCAGAGTGGGATAATT0.1
      DYS713(TCTT)mTC(TCTT)2(TCTG)1(TCTT)TTT(TCTT)TC (TCTT)nTT(TCTT)5CCT(TCTT)TC(TCTT)T(TCTT)12267–311TGTAAAACGACGGCCAGTCCAGAAATAGATTTATTCACGCTTG0.084345
      CCTGGGTGACAGACTCCATCTTAAA0.8
      DYS607(AAGG)m7369–393TGTAAAACGACGGCCAGTCATACAGCGTAATCACAGCTCAC0.041512
      GTAATGATGCCTCCAGTAACCAA0.1
      SetB
      Joe-M13TGTAAAACGACGGCCAGT0.25
      DYS718(TTA)m7153–171TGTAAAACGACGGCCAGTGGAGAAAATTCAATGCAGTTACC0.081513
      ACACCAGCTTGGCACATTTA0.6
      DYS723(GATA)2TAT(GATA)mGAT(GATA)1GAT(GATA)78195–223TGTAAAACGACGGCCAGTGACAGGTGGATGCATAAATGG0.081921
      TCTGGCATCTGTCTGCATATTT0.1
      DYS708(GATA)m (GACA)n8249–277TGTAAAACGACGGCCAGTAGTGTATCCGCCATGGTAGC0.082828
      CTGCATTTTGGTACCCCATA0.2
      DYS714(TTTTC)m(TCTTC)2(TTTTC)2(TCTTC)2(TTTTC)213282–342TGTAAAACGACGGCCAGTGCATCGATCTTTCTGGGAGC0.083233
      GTGTGATGCTGACTTTGGGG0.2
      SetC
      TAMRA-M13TGTAAAACGACGGCCAGT0.25
      DYS712(AGAT)m(AGAC)n18169–237TGTAAAACGACGGCCAGTCAAGAACAGCCTGGGTAACAGTG0.0161919
      TATATGGTACAGCCCATGAACACTT0.1
      DYS717(TGTAT)2TAT(TGTAT)(TGTAT)m(TGTAT)n7257–287TGTAAAACGACGGCCAGTGGCCGAGAGAATGGAATTGAT0.081919
      CCCGAACTTCAGCACTATGAAATG0.2
      DYS721(AAGGG)mN10(AAGGG)2N7(AAGCA)67298–328TGTAAAACGACGGCCAGTGGGTGATAGAGGGAGGCTTCT0.0161920
      CGGGCATGAGCTATTGAGTC0.1
      DYS605(TATC)4CA(TATC)3CG(TATC)m6380–400TGTAAAACGACGGCCAGTAACATCTGGCTTACTTGTAGGTAG0.082018
      TCTTTGTCAGACAATGATCTGTAA0.2
      SetD
      ROX-M13TGTAAAACGACGGCCAGT0.25
      DYS719(ATA)m7171–189TGTAAAACGACGGCCAGTTGACGAGTTAATGGGTGCAG0.0161213
      GGAGAAAATTCAATGCAGAT0.1
      DYS726(CTTC)3N13 (CTTC)mN21(CTTT)3T(CTTT)27214–238TGTAAAACGACGGCCAGTGGGTAAACCTCTGAAGACCATAC0.0499
      GAATGACAGACCAAGACTCTCTC0.1
      DYS598(AGAAC)m5267–287TGTAAAACGACGGCCAGTCTTTATTAGGCAGGCAGTTTTG0.0479
      CCAGACAATGTATGAGCAAGC0.1
      DYS722(GAAA)mAAGA(GAAA)2A(GAAA)2GAGA(GAAA)211336–376TGTAAAACGACGGCCAGTCCACTCATCAGTGCTCAGCTA0.042120
      GCCAACCAGCAATGTTGTC0.1
      All individuals were analyzed in four independent multiplex PCRs (Sets A, B, C, and D). Each PCR was performed by using 1 ng of DNA in a total volume of 15 μL, containing (0.008 μM–0.8 μM) forward primers and reverse primers, 0.25 μM of the fluorescent universal M13 (−21) primers, and 1x PCR MasterMix (Mei5 Biotechnology (Beijing) Co, Ltd). Reaction conditions were as follows: 95 ℃ for 10 min; 25 cycles of 95 ℃ for 25 s, 56 ℃ for 25 s, and 72 ℃ for 25 s; 8 cycles of 95 ℃ for 25 s, 53 ℃ for 25 s, and 72 ℃ for 25 s; and a final extension at 72 ℃ for 60 min. The PCR products were subjected to standard capillary electrophoresis by 3130 Genetic Analyzer (Applied Biosystems).
      The allele and haplotype frequencies were counted directly. Gene diversity (GD) and haplotype diversity (HD), match probability (MP) and discrimination capacity (DC) were calculated as described by Jian Zhang et al. [
      • Zhang J.
      • Mo X.
      • Zhang Y.
      • et al.
      Genetic analysis of 26 Y-STR loci in Han population from Leshan, Southwest China.
      ].

      3. Results and discussion

      The representative electropherogram of a single sample is shown in Fig.1. Allele frequencies of the 17 Y-STRs in Shanxi population were listed in Table S1. The allele frequency ranged from 0.0025 to 0.7716. A total of 131 haplotypes were detected. Haplotype diversity (HD) ranged from 0.3721 (DYS598) to 0.9125 (DYS712). Match probability (MP) ranged from 0.0898 (DYS712) to 0.6288 (DYS598). The discrimination capacity (DC) was 1.
      Fig. 1
      Fig. 1Electropherogram of a single male sample.

      4. Conclusion

      As a result of this study, we developed a new 17-plex Y-STR typing system for forensic genetic testing, which incorporated the loci out of the current Yfiler Plus kit. Allele frequencies of the 17 Y-STRs would be used for forensic personal identification and paternity testing in the Shanxi population.

      Declaration of Competing Interest

      None.

      Acknowledgments

      This work was supported by Hubei Chongxin Judicial Expertise Center & Liu Liang Personal Studio ( CXLL20170002 ).

      Appendix A. Supplementary data

      The following is Supplementary data to this article:

      References

        • Zhao Z.L.
        • Xia L.
        • Zhao C.
        • et al.
        Population genetics of 15 autosomal STR loci in the Han population of Ili Kazakh Autonomous Prefecture, Northwestern China.
        Ann. Hum. Genet. 2019; 83: 318-324
        • Guan T.
        • Song X.
        • Xiao C.
        • et al.
        Analysis of 23 Y-STR loci in Chinese Jieyang Han population.
        Int. J. Legal Med. 2019; (Epub ahead of print)
        • Gao H.M.
        • Wang C.
        • Han S.Y.
        • et al.
        Analysis of the 19 Y-STR and 16 X-STR loci system in the Han population of Shandong province, China.
        Genet. Mol. Res. 2017; 16
        • Zhang G.Q.
        • Yang S.Y.
        • Niu L.L.
        • et al.
        Structure and polymorphism of 16 novel Y-STRs in Chinese Han population.
        Genet. Mol. Res. 2012; 11: 4487-4500
        • Zhang G.Q.
        • Wang Y.
        • Zhang Y.X.
        • et al.
        Study of polymorphism at new Y-STR DYS605 in a Chinese Han population of Shanxi.
        Yi Chuan. 2004; 26: 295-297
        • Zhang G.Q.
        • Yun K.M.
        • Zhang Y.X.
        • et al.
        Allele frequencies for two new Y-chromosome STR loci DYS598 and DYS607 in Chinese Han population (Shanxi area).
        J. Forensic Sci. 2004; 49: 630
        • Oka K.
        • Asari M.
        • Omura T.
        • et al.
        Genotyping of 38 insertion/deletion polymorphisms for human identification using universal fluorescent PCR.
        Mol. Cell. Probes. 2014; 28: 13-18
        • Zhang J.
        • Mo X.
        • Zhang Y.
        • et al.
        Genetic analysis of 26 Y-STR loci in Han population from Leshan, Southwest China.
        Forensic Sci. Int. Genet. 2018; 37: e15-e16