Advertisement

High resolution melting analysis (HRM) based on 16SrRNA as a tool for personal identification with the human oral microbiome

  • Author Footnotes
    1 The author contributed equally to this work and should be considered co-first author.
    Shuangshuang Wang
    Footnotes
    1 The author contributed equally to this work and should be considered co-first author.
    Affiliations
    Department of West China School of Basic Medical Sciences & Forensic Medicine, Sichuan University, Forensic Genetics, Chengdu 610041, China
    Search for articles by this author
  • Author Footnotes
    1 The author contributed equally to this work and should be considered co-first author.
    Feng Song
    Footnotes
    1 The author contributed equally to this work and should be considered co-first author.
    Affiliations
    Department of West China School of Basic Medical Sciences & Forensic Medicine, Sichuan University, Forensic Genetics, Chengdu 610041, China
    Search for articles by this author
  • Yanyun Wang
    Affiliations
    Laboratory of Molecular Translational Medicine, Center for Translational Medicine, Key Laboratory of Birth Defects and Related Diseases of Women and Children, Ministry of Education, Department of Obstetrics and Gynecology, West China Second University Hospital, Sichuan University, Chengdu 610041, China
    Search for articles by this author
  • Yun Huang
    Affiliations
    Department of West China School of Basic Medical Sciences & Forensic Medicine, Sichuan University, Forensic Genetics, Chengdu 610041, China
    Search for articles by this author
  • Bowen Xie
    Affiliations
    Department of West China School of Basic Medical Sciences & Forensic Medicine, Sichuan University, Forensic Genetics, Chengdu 610041, China
    Search for articles by this author
  • Haibo Luo
    Correspondence
    Corresponding author at: 3-16 Renmin South Road, Chengdu, 610041, China.
    Affiliations
    Department of West China School of Basic Medical Sciences & Forensic Medicine, Sichuan University, Forensic Genetics, Chengdu 610041, China
    Search for articles by this author
  • Author Footnotes
    1 The author contributed equally to this work and should be considered co-first author.
Published:September 25, 2019DOI:https://doi.org/10.1016/j.fsigss.2019.09.063

      Abstract

      Personal identification plays an important role in the forensic practice. The conventional methods of personal identification including STR, SNP and InDel are focusing on the molecular characteristics of the human cell. Recently, researchers pay attention to human microbiome by the reason that the human microbiome is rich in amount and variable among people. The purpose of this study is to apply the human oral microbiome to forensic personal identification. We designed one general primer pair: 518 F&806R, which targeted the 16SrRNA. We conducted the high-resolution melting analysis (HRM) with the one primer pairs. The results indicated that oral microbiome from different people could be distinguished by using HRM based on 16SrRNA. This study showed that human oral microbiome could be a promising marker for the forensic personal identification application.

      Keywords

      1. Introduction

      Human oral cavity owes the second most abundant microbiota after gastrointestinal tract [
      • Verma D.
      • Garg P.K.
      • Dubey A.K.
      Insights into the human oral microbiome.
      ], and the human oral microbiome is influenced by many factors, such as gene, diet, and hygiene etc. which cause the composition of human oral microbiome is unique among the individuals. Human oral microbiome potentially applies in forensic personal identification. Recently, the potential of human microbiome applies in the forensic personal identification, most of these studies use the next generation sequence to acquire the sequence information of the human microbiome for the bioinformatic analysis [
      • Schmedes S.E.
      • et al.
      Targeted sequencing of clade-specific markers from skin microbiomes for forensic human identification.
      ]. The cost of the next generation sequencing is a problem to study with large amounts of samples. An accurate, rapid and low-cost method should be applied before the sequencing. The researchers had used the High-Resolution Melting Analysis of 16SrRNA gene variable region for studying the comparison of bacteria community composition in soil sample [
      • Hjelmsø M.H.
      • et al.
      High-resolution melt analysis for rapid comparison of bacterial community compositions.
      ] and the rapid differentiation of bacterial community in tadpole digestive tract and feces samples [
      • Everman S.
      • Wang S.Y.
      Rapid differentiation of bacterial communities using high resolution melting analysis.
      ]. So, the High-Resolution Melting Analysis can be a tool to demonstrate the discrepancy of human oral microbiome.

      2. Materials and methods

      Five healthy volunteers participated the study, two males and three females respectively. The five volunteers did not treat with antibiotics in the past three months. The volunteers were required to not eat food or drink water at least one hour before sampling. Totally, five saliva samples and five oral swab samples were collected. These samples were named as Sa1, Sa2, Sa3, Sa4, Sa5, Os1, Os2, Os3, Os4, Os5, respectively. The genomic DNA was extracted using QIAmp® DNA Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. Extracted DNA was quantified by Nanodrop™ 2000 spectrophotometer (Thermo Scientific,Wilmington, NC, USA). Forward primer and reverse primer were 518 F CCAGCAGCCGCGGTAAT and 806R GGACTACCAGGGTATCTAATCCTGTT respectively, targeting at 16S rRNA V4 region of bacteria [
      • Si J.
      • Lee C.
      • Ko G.
      Oral microbiota: microbial biomarkers of metabolic syndrome independent of host genetic factors.
      ]. The reaction mixture with a final volume of 10 μl contained: 0.2 μM forward primer and reverse primer, 10 ng genomic DNA, 5 μl 2×Light Cycler® 480 High Resolution Melting Master Mix (Roche, Mannheim, Germany), 1.2 μl 25 Mm MgCl2 and DNase/RNase free water. The touch down PCR and High-resolution melting analysis was performed on the Light Cycler 480(Roche, Mannheim, Germany). The condition of touch down PCR was 95℃ for 10 min, 55 cycles of 94℃ for 10 s, annealing at 65℃ for 10 s with a 0.5℃ decrease in temperature after each cycle down to 53℃, and extension at 72℃ for 10 s. HRM analysis was performed at the end of PCR protocol under the following condition: 95℃ for 1 min, 40℃ for 1 min, temperature continuously increased from 75℃ to 95℃ at a 0.2℃/s to acquire sample fluorescence, 40℃ for 10 s to cool. The result of the HRM was analyzed according to the Light Cycler 480 software.

      3. Results and discussion

      The result of HRM revealed the presence of distinct microbial communities in different human oral cavity. HRM analysis of the 16S rRNA V4 region showed the amplicon melting curve profiles had a discrepancy in different saliva samples. Five saliva samples from different individuals were divided into four groups (shown in Fig. 1). Sa1 and Sa5 were divided into a same group: blue. The reason may be that the two persons lived in the same circumstances. Their diet was similar, and they shared same environment, resulting in small difference in their oral microbial communities. The melting curve profiles of Sa5 was in accordance with Os5 (shown in Fig. 2). Sa5 and Os5 were divided into a same group, and the melting curves were similar. Another melting curve profiles of saliva samples and oral swab samples, which cannot match well. It may explain by the saliva samples contained not only the oral microbiome, but also the microbiome of throat.
      Fig. 1
      Fig. 1The melting curve profiles of five individuals’ saliva samples.
      Fig. 2
      Fig. 2The melting curve profiles of one individual’s saliva sample and oral swab sample.

      4. Conclusion

      According the primary study, we demonstrated there existed discrepancy in different human oral microbiome. This discrepancy provides the basis of personal identification. We can apply some more accurate method like sequencing to further analysis the discrepancy. The human oral microbiome has the potential to be a promising marker for the forensic application.

      Declaration of Competing Interest

      None.

      Acknowledgements

      This study was supported by the National Natural Science Foundation of China (NSFC, No.81772030 and81701866), the Postdoctoral Fund of Sichuan University (No. 2017SCU12049), and the Outstanding Youth Fund of Sichuan University (No. 2016SCU04A07).

      References

        • Verma D.
        • Garg P.K.
        • Dubey A.K.
        Insights into the human oral microbiome.
        Arch. Microbiol. 2018; 200: 525-540
        • Schmedes S.E.
        • et al.
        Targeted sequencing of clade-specific markers from skin microbiomes for forensic human identification.
        Forensic Sci. Int. Genet. 2018; 32: 50-61
        • Hjelmsø M.H.
        • et al.
        High-resolution melt analysis for rapid comparison of bacterial community compositions.
        Appl. Environ. Microbiol. 2014; 80: 3568-3575
        • Everman S.
        • Wang S.Y.
        Rapid differentiation of bacterial communities using high resolution melting analysis.
        J. Microbiol. Methods. 2017; 140: 77-81
        • Si J.
        • Lee C.
        • Ko G.
        Oral microbiota: microbial biomarkers of metabolic syndrome independent of host genetic factors.
        Front. Cell. Infect. Microbiol. 2017; 7: 516