Advertisement

Mitochondrial DNA study in the Shuar ethnic group from Ecuador

Published:September 24, 2019DOI:https://doi.org/10.1016/j.fsigss.2019.09.055

      Abstract

      This study presents mitochondrial data from 55 unrelated individuals from two Ecuadorian Shuar communities: Kumbatza and Yukateis. Maternal linage was determined by analyzing the two mtDNA hypervariable regions: HRVI and HRVII. It was shown that the Shuar population exhibited the haplogroup B. This demonstrates that Shuar group is a conserved population with no mixing with the European and African diaspora populations.

      Keywords

      1. Introduction

      Ecuador is a multiethnic country [
      • Paz-y-Miño C.
      • Guillen Sacoto M.J.
      • Leone P.E.
      Genetics and genomic medicine in Ecuador.
      ,
      • Paz-y-Miño C.
      • Burgos G.
      • Cabrera-Andrade A.
      • et al.
      Determination of proportions of molecular ancestry in Ecuadorian ethnic groups.
      ,
      • Zambrano A.K.
      • Gaviria A.
      • Vela M.
      • et al.
      Ancestry characterization of Ecuador´s highland mestizo population using autosomal AIM-IDELs.
      ,
      • Zambrano A.K.
      • Gaviria A.
      • Cobos-Navarrete S.
      • et al.
      The three-hybrid genetic composition of an Ecuadorian population using AIMs-InDels compared with autosomes, mitochondrial DNA and Y chromosome data.
      ] composed of 21 indigenous groups, among these the Shuar are settled in around 668 communities in different provinces of the Ecuadorian Amazon region (Provinces: Napo, Pastaza, Morona Santiago, Zamora Chinchipe, Sucumbíos and Orellana), the coast region (Provinces: Esmeraldas and Guayas), as well as in the Peruvian Amazon state. According to population census 80 000 individuals belong to this ethnic group, of which 22 000 live in Sucumbíos province. Their anthropological isolation due to their lifestyle and language, make them an appealing group for genetic studies. mtDNA analysis is a convenient tool for population studies because of its maternal inheritance, elevated mutation rate, high copy number per cell, no recombination, not easily degraded material. This has been commonly used to infer ancestry or reconstruct ethnic history [
      • Baeta M.
      • Nuñez C.
      • Sosa C.
      • et al.
      Mitochondrial diversity in Amerindian Kichwa and mestizo populations from Ecuador.
      ]. The aim of this work was to identify the haplogroups existing in Shuar population and if they are related to their historical process.

      2. Materials and methods

      2.1 Samples

      75 Ecuadorian Shuar individuals from Kumbatza and Yukateis communities from parish Huambi, canton Sucua and Morona Santiago province (Fig. S1 in the Supplementary Information) were enrolled after they signed the informed consent and their fingerprints were taken. Family trees were constructed to selected only 55 unrelated male and female individuals. This study was approved by the Human Research Ethics Committee of Universidad San Francisco de Quito 2018-127E.

      2.2 mtDNA study

      DNA was extracted from peripheral blood, collected via finger puncture in FTA Whatman paper, using Chelex 10% protocol along with boiling for cell lysis. DNA quality was assessed by NanoDrop 2000 Spectrophotometer (Thermo Scientific, USA). To detect mutations in HVRI and HVRII, primers with annealing temperatures of 56 °C were used; for HVRI: F: 5′ CACCATTAGCACCCAAAGCT 3′, R: 5′ CCCGTGAGTGGTTAATAGGT 3′ and for HRVII: F: 5′ CCCACACGTTCCCCTTAAAT 3′, R: 5′ CCCACACGTTCCCCTTAAAT 3′, and the standard protocols for 3130 Genetic Analyzer (Applied Biosystems, Life Technologies, USA). The data was analyzed in the Sequence Analysis software. Geneious software was used for sequence alignment of HVRI and HVRII with Cambridge Reference Sequence, polymorphic sites were recorded and haplogroups identified.

      3. Results

      The mtDNA study showed that the Shuar population exhibit the haplogroup B which belongs to the Native American population. The haplogroup identified in this the Shuar population is depicted in Table S1 (Supplementary Information) along with other haplogroups identified in Andean Native American populations.

      4. Discussion

      There are several theories that arose on how American continent was initially populated. However, genetic studies have postulated that Bering Strait migration during the last glacial maximum through the ice-free corridor around 15–18 thousand years ago, could possibly explain mtDNA haplogroups geographical distribution in Pan-America [
      • Perego U.A.
      • Angerhofer N.
      • Pala M.
      • et al.
      The initial peopling of the Americas: a growing number of founding mitochondrial genomes from Beringia.
      ]. It has been documented that the most commonly reported haplogroups in Amerindians A–D [
      • Zambrano A.K.
      • Gaviria A.
      • Cobos-Navarrete S.
      • et al.
      The three-hybrid genetic composition of an Ecuadorian population using AIMs-InDels compared with autosomes, mitochondrial DNA and Y chromosome data.
      ,
      • Perego U.A.
      • Angerhofer N.
      • Pala M.
      • et al.
      The initial peopling of the Americas: a growing number of founding mitochondrial genomes from Beringia.
      ,
      • Hooshiar Kashani B.
      • Perego U.A.
      • Olivieri A.
      • et al.
      Mitochondrial haplogroup C4c: a rare lineage entering America through the ice-free corridor?.
      ]. In a study in South America, the Andean population have a high predominance of haplotype B, when compare with North-South Amazon and Southern population [
      • Rodriguez-Delfin L.A.
      • Rubin-de-Celis V.E.
      • Zago M.A.
      Genetic diversity in an Andean population from Peru and regional migration patterns of Amerindians in South America: data from Y chromosome and mitochondrial DNA.
      ]. Besides, our result is in accordance with 61% Native populations in Ecuador and Peru mentioned in Table S1 (Supplementary Information), as they showed high abundance of haplogroup B [
      • Rickards O.
      • Martínez-Labarga C.
      • Lum J.K.
      • et al.
      mtDNA history of the Cayapa Amerinds of Ecuador: detection of additional founding lineages for the Native American populations.
      ,
      • Sandoval J.R.
      • Lacerda D.R.
      • Acosta O.
      • et al.
      The genetic history of Peruvian Quechua-Lamistas and Chankas: uniparental DNA patterns among autochthonous Amazonian and Andean populations.
      ]. One can hypothesize that the reason we were not able to find other haplogroup in our sample is that Amerindian groups are closed populations with high inbreeding levels or bottlenecks thus presenting a low diversity range [
      • Baeta M.
      • Nuñez C.
      • Sosa C.
      • et al.
      Mitochondrial diversity in Amerindian Kichwa and mestizo populations from Ecuador.
      ]. Cardoso [
      • Cardoso S.
      • Alfonso-Sánchez M.A.
      • Valverde L.
      • et al.
      Genetic uniqueness of the Waorani tribe from the Ecuadorian Amazon.
      ] has found only one haplogroup when studying Waorani population. This demonstrates that Shuar group is a conserved population with no mixing with the European and African diaspora populations.

      5. Conclusion

      This study is the first in characterizing the mtDNA of the Ecuadorian Shuar ethnic group, it describes the presence of one of the founder haplogroups from the Native Americans and demonstrates that the Shuar are a conserved population with no mixing with the European and African diaspora populations from Ecuador.

      Funding

      None.

      Declaration of Competing Interest

      None.

      Acknowledgement

      None.

      Appendix A. Supplementary data

      References

        • Paz-y-Miño C.
        • Guillen Sacoto M.J.
        • Leone P.E.
        Genetics and genomic medicine in Ecuador.
        Mol. Genet. Genomic Med. 2015; 4: 9-17
        • Paz-y-Miño C.
        • Burgos G.
        • Cabrera-Andrade A.
        • et al.
        Determination of proportions of molecular ancestry in Ecuadorian ethnic groups.
        in: Leone P.E. Paz-y-Miño C. Genetics in Ecuador: 30 Years. IIB-UDLA, Quito2016: 481-482
        • Zambrano A.K.
        • Gaviria A.
        • Vela M.
        • et al.
        Ancestry characterization of Ecuador´s highland mestizo population using autosomal AIM-IDELs.
        Forensic Sci. Int. 2017; 6 (e477-e478)
        • Zambrano A.K.
        • Gaviria A.
        • Cobos-Navarrete S.
        • et al.
        The three-hybrid genetic composition of an Ecuadorian population using AIMs-InDels compared with autosomes, mitochondrial DNA and Y chromosome data.
        Sci. Rep. 2019; 9: 9247
        • Baeta M.
        • Nuñez C.
        • Sosa C.
        • et al.
        Mitochondrial diversity in Amerindian Kichwa and mestizo populations from Ecuador.
        Int. J. Leg. Med. 2012; 126: 299-302
        • Perego U.A.
        • Angerhofer N.
        • Pala M.
        • et al.
        The initial peopling of the Americas: a growing number of founding mitochondrial genomes from Beringia.
        Genome Res. 2010; 20: 1174-1179
        • Hooshiar Kashani B.
        • Perego U.A.
        • Olivieri A.
        • et al.
        Mitochondrial haplogroup C4c: a rare lineage entering America through the ice-free corridor?.
        Am. J. Phys. Anthropol. 2012; 147: 35-39
        • Rodriguez-Delfin L.A.
        • Rubin-de-Celis V.E.
        • Zago M.A.
        Genetic diversity in an Andean population from Peru and regional migration patterns of Amerindians in South America: data from Y chromosome and mitochondrial DNA.
        Hum. Hered. 2001; 51: 97-106
        • Rickards O.
        • Martínez-Labarga C.
        • Lum J.K.
        • et al.
        mtDNA history of the Cayapa Amerinds of Ecuador: detection of additional founding lineages for the Native American populations.
        Am. J. Hum. Genet. 1999; 65: 519-530
        • Sandoval J.R.
        • Lacerda D.R.
        • Acosta O.
        • et al.
        The genetic history of Peruvian Quechua-Lamistas and Chankas: uniparental DNA patterns among autochthonous Amazonian and Andean populations.
        Ann. Hum. Genet. 2016; 80: 88-101
        • Cardoso S.
        • Alfonso-Sánchez M.A.
        • Valverde L.
        • et al.
        Genetic uniqueness of the Waorani tribe from the Ecuadorian Amazon.
        Heredity (Edinb). 2012; 108: 609-615