Advertisement
Journal Home
Search for

Volume 2, Issue 1, Pages 25-26 (December 2009)


View previous. 14 of 253 View next.

Development and validation of a next generation STR ESS-pentaplex

Christopher PhillipsaCorresponding Author Informationemail address, Anna Barbarob, Luís Fernandez Formosoa, David Ballardc, Denise Syndercombe Courtc, Ángel Carracedoa, Maviky Lareua

Received 26 August 2009; accepted 27 August 2009. published online 12 October 2009.

Abstract 

We constructed a simple STR pentaplex of new loci recommended as next generation markers for the European Standard Set (ESS) comprising normal-amplicon STRs: D12S391 and D1S1656, plus mini-amplicon STRs: D2S441, D10S1248 and D22S1045. Validation of the pentaplex included evaluation of its ability to amplify DNA from a variety of degraded forensic casework samples. Although the ESS-pentaplex was designed in the first instance to generate allele frequency data to supplement existing databases of established STRs, the multiplex proved to be a valuable tool for the analysis of challenging DNA when certain markers of Identifiler or MiniFiler occasionally failed.

Article Outline

Abstract

1. Introduction

2. Materials and methods

3. Results and discussion

4. Conflict of interest statement

References

Copyright

1. Introduction 

return to Article Outline

Two problems regularly confront forensic DNA analyses with the routine use of standard STRs: insufficient discrimination power and presence of highly degraded DNA where locus and allele drop-out can lead to complex interpretative problems. Success with highly degraded DNA is improved using short amplicon mini-STRs. We decided to develop a bolt-on STR pentaplex of five new loci, recommended as next generation markers for the European Standard Set (ESS) in order to generate allele frequency data ahead of the release of ESS kits. The ESS-pentaplex comprises two tried and tested STRs: D12S391 and D1S1656, that are highly informative but with conventional amplicon lengths, plus three mini-STRs: D2S441, D10S1248 and D22S1045 typed with amplicon size ranges 74–135bp. Space exists in this multiplex amongst the fragment sizes and green/yellow dye labels to allow additional STRs to be included in future. As part of the validation of the ESS-pentaplex we assessed its ability to amplify DNA from a range of degraded casework samples including hairs, bones, nails and washed bloodstains. In routine forensic use the ESS-pentaplex provided a valuable additional approach for the analysis of challenging DNA, even when some standard STRs in commercial kits failed or were too weak.

2. Materials and methods 

return to Article Outline

As commercial primer designs for the five new ESS STRs are not published we used our original primers for D1 and D12 [1], [2] together with those detailed in STRbase from the original developers for D2, D10 and D22 [3]. Amplicon sizes, primer sequences and dye labels are outlined in Table 1. These show that sufficient space exists for inclusion of additional informative STRs such as SE33 or D9S1120 [4] labeled with NED or VIC. For each STR reference ladders were constructed from sequenced alleles using standard procedures as previously described [4].

Table 1.

PCR primer designs, dye labels and amplicon sizes of the pentaplex STRs. Observed (obs.) allele sizes obtained from an AB 3730xl and POP7.

STR
Dye
PCR primer sequence
Obs. repeat numbers
Obs. sizes
Actual sizes
D10S1248F6-FAMTTAATGAATTGAACAAATGAGTGAG87982
R gCAACTCTGGTTGTATTGTCTTCAT19123126
D1S1656F GTGTTGCTCAAGGGTCAACT8131135
R6-FAMctctctctctctctccttGAGAAATAGAATCACTAGGGA19.3181182
D12S391F AACAGGATCAATGGATGCAT12194197
R6-FAMTGGCTTTTAGACCTGGACTG27.2261259
D2S441FVICCTGTGGCTCATCTATGAAAACTT87477
R gAAGTGGCTGTGGTGTTATGAT17112113
D22S1045FNEDATTTTCCCCGATGATAGTAGTCT9105106
R CGGCACAGTGTGAGTGATCAC19135136

The quality of results obtained from challenging forensic material was evaluated by assessing the relative performance and locus drop-out of STRs in partial profiles measured as percentage genotyping success. Detectable peaks below a prescribed minimum signal of 100 RFU were also recorded.

3. Results and discussion 

return to Article Outline

The percentage genotyping success rates observed in 49 challenging casework samples for Identifiler, MiniFiler and the ESS-pentaplex are summarized in Fig. 1. Although this study examined a wide range of degraded forensic material, the three multiplexes showed a consistent pattern of relative success. The ESS-pentaplex showed an average 97.6% success (94.7% when peaks below 100 RFU were excluded); MiniFiler an average 89.8% (88.0%) and; Identifiler 81.5% (80.8%). Clearly calculating success for the small-scale pentaplex is not completely comparable to larger multiplexes, but the limited number of PCR components benefits performance and the pentaplex is an informative supplement to either Identifiler or MiniFiler with better overall chance of success. It is interesting to note that the only ESS-pentaplex STR showing locus drop-out (8%) was D10S1248, while both normal-amplicon STRs worked almost as well as the other two mini-STRs that showed complete success with all material genotyped.


View full-size image.

Fig. 1. Percent genotyping success for three forensic multiplexes (Identifiler, 15 STRs; MiniFiler, 8; ESS-pentaplex, 5) in 49 challenging casework samples. Multiple overlaying points shown as grey (black if 0%). Points with dark outlines show success when excluding genotype peaks below a prescribed minimum 100RFU.


4. Conflict of interest statement 

return to Article Outline

None.

References 

return to Article Outline

[1]. [1]Lareu MV, Pestoni C, Schürenkamp M, Rand S, Brinkmann B, Carracedo Á. A highly variable STR at the D12S391 locus. Int. J. Legal Med. 1996;109:134–138. MEDLINE | CrossRef

[2]. [2]Lareu MV, Barral S, Salas A, Pestoni C, Carracedo Á. Sequence variation of a hypervariable short tandem repeat at the D1S1656 locus. Int. J. Legal Med. 1998;111:244–247. MEDLINE | CrossRef

[3]. [3]Butler JM, Shen Y, McCord BR. The development of reduced size STR amplicons as tools for analysis of degraded DNA. J. Forensic Sci. 2003;48:1054–1064. MEDLINE

[4]. [4]Phillips C, Rodriguez A, Mosquera-Miguel A, Fondevila M, Porras-Hurtado L, Rondon F, et al. D9S1120, a simple STR with a common Native American-specific allele: forensic optimization, locus characterization and allele frequency studies. Forensic Sci. Int. Genet. 2008;3:7–13.

a Forensic Genetics Unit, Institute of Legal Medicine, University of Santiago de Compostela, Santiago de Compostela, Spain

b Department of Forensic Genetics, SIMEF, Reggio Calabria, Italy

c Haematology, ICMS, Barts and The London, UK

Corresponding Author InformationCorresponding author. Tel.: +34 981 582 327; fax: +34 981 580 336.

PII: S1875-1768(09)00203-0

doi:10.1016/j.fsigss.2009.08.190


View previous. 14 of 253 View next.