Forensic Science International: Genetics Supplement Series
Volume 2, Issue 1 , Pages 21-22, December 2009

Development of two new Mini-STR multiplex assay for typing archival Bouin's fluid-fixed paraffin-embedded tissues

  • Stefania Turrina

      Affiliations

    • Department of Medicine and Public Health, Institute of Legal Medicine, Forensic Genetic Laboratory, University of Verona, Policlinico G.B. Rossi – P.le L.A. Scuro, 37134 Verona, Italy
    • Corresponding Author InformationCorresponding author. Tel.: +39 045 8124942; fax: +39 045 8027479.
  • ,
  • Giulia Filippini

      Affiliations

    • Department of Medicine and Public Health, Institute of Legal Medicine, Forensic Genetic Laboratory, University of Verona, Policlinico G.B. Rossi – P.le L.A. Scuro, 37134 Verona, Italy
  • ,
  • Luciana Caenazzo

      Affiliations

    • Department of Environmental Medicine and Public Health, Legal Medicine Section, University of Padua, Via Falloppio 50, 35121 Padova, Italy
  • ,
  • Domenico De Leo

      Affiliations

    • Department of Medicine and Public Health, Institute of Legal Medicine, Forensic Genetic Laboratory, University of Verona, Policlinico G.B. Rossi – P.le L.A. Scuro, 37134 Verona, Italy

Received 21 August 2009; accepted 26 August 2009. published online 05 October 2009.

Article Outline

Abstract 

Short amplicon autosomal short tandem repeat (Mini-STR) assay has proved to be a highly useful tool in forensic applications, especially for highly degraded DNA samples that typically result in partial profiles and total loss of information from regular STR amplicons.

In this study two new quadruplex systems were designed to get nuclear DNA profile from degraded forensic casework samples. In order to obtain PCR products less than 120bp in size, primer pairs of eight STR markers, included in available commercially multiplex PCR kits, were redesigned and assembled in two PCR-multiplexes: D8S1179, D3S1358, TPOX, D16S539 and CSF1P0, TH01, D13S317, D5S818.

After validation, these two Mini-STR quadruplex were employed in paternity testing case that involved DNA extraction from archival postmortem Bouin's fluid-fixed paraffin-embedded tissue where commercial kit yielded low success. The results obtained with the present Mini-STR PCR-multiplexes proved clearly demonstrating their usefulness in analyzing degraded DNA samples.

Keywords: Autosomal Mini-STR, Quadruplex, Degraded DNA

 

Back to Article Outline

1. Introduction 

Paternity testing is generally ascertained using buccal swab or blood samples, but other biological materials such as biopsy paraffin-embedded tissues are potential samples for DNA extraction and genetic testing. Degradation and low quantity of high molecular weight DNA, produced by intrinsic and extrinsic characteristics of samples, fail often to yield reproducible results using commercial multiplex STR systems. The loss of signal is specially observed with larger-sized STR products. The need to obtain a genetic profile from degraded DNA has led to redesigned STR primers that generate shorter amplicons to increase the number of template molecules available for the PCR [1].

In this study the primer pairs of eight conventional STR markers, were redesigned in order to obtain amplicons less than 120bp in size and were assembled in two new Mini-STR PCR-multiplexes that, after validation, were employed in a paternity testing case to get nuclear DNA profile from archival postmortem Bouin's fluid-fixed paraffin-embedded tissue.

Back to Article Outline

2. Materials and methods 

Eight conventional STR markers (D8S1179, D3S1358, TPOX, TH01, D5S818, CSF1P0, D13S317, D16S539) included in multiplex PCR kits commercially available, were redesigned and converted into Mini-STR, in order to reduce or eliminate the polymorphism's flanking regions. The eight STRs were amplified in two quadruplex: D8S1179, D3S1358, TPOX, D16S539 and CSF1P0, TH01, D13S317, D5S818 (see Table 1).

Table 1. Primer sequences and PCR product sizes of the two Mini-STR quadruplex systems.
LocusMini-STR primers (5′–3′)Allele rangeMini-STR size (bp)
D8S1179F [6-FAM] GTATTTCATGTGTACATTCG
R GATTATTTTCACTGTGGGG
8–1968–112
D3S1358F [VIC] CAGAGCAAGACCCTGTCT
R GAAATCAACAGAGGCTTGC
8–1973–117
TPOXF [NED] AGGCACTTAGGGAACCCT
R GTCAGCGTTTATTTGCCC
6–1364–92
D16S539F [PET] CAGACAGACAGACAGGTG
R GTATCTATCATCCATCTCTG
8–1586–114
CSF1P0F [6-FAM] CAGTAACTGCCTTCATAGATAG
R GACCCTGTTCTAAGTACTTCC
6–1582–118
TH01F [VIC] ATTCCCATTGGCCTGTTC
R GTCACAGGGAACACAGACTC
4–13.369–115
D13S317F [NED] GCCTATCTGTATTTACAAATAC
R CCCAAAAAGACAGAAAGAA
8–1592–120
D5S818F [PET] CCTCTTTGGTATCCTTATGT
R CTTTATCTGTATCCTTATTTATACC
7–1684–120

DNA amplification of the two quadruplex was performed in a reaction volume of 12.5μl using Qiagen® Multiplex PCR kit (Qiagen, Hilden, Germany) following the manufacturer's recommendations in terms of primers and DNA concentrations. Thermal cycling was performed with a GeneAmp 9700 (Applied Biosystem) using following conditions: 95°C for 15min, 28 cycles at 94°C for 30s, 57°C for 1.30min, 72°C for 1min, 60°C for 30min and 4°C forever.

Allelic ladders for Mini-STRs were created using 1:1000 dilution of allelic ladder from Identifiler kit®. 2μl of these diluted ladders were amplified in the two quadruplex sets using the thermal cycling parameters outlined for the PCR above, except amplified for 15 cycles instead of the standard 28 cycles [1]. The cell line samples K562 and 9947A (Promega, Milan, Italy) were used as control DNA for calibrating allelic ladders.

DNA extracted from 100 buccal swab provided by healthy donors and previously typed with Identifiler® and Minifiler™, were analyzed to validate the new PCR-multiplexes. Furthermore, DNA extraction from postmortem Bouin's fluid-fixed paraffin-embedded tissue samples was performed by QIAamp DNA Investigator kit (Qiagen), amplified by Amp-FlSTR Identifiler® PCR Amplification Kit (Applied Biosystems) and subsequently by Amp-FlSTR®MiniFiler™ PCR Amplification Kit (Applied Biosystems) according to manifacturer's recommendations.

All PCR amplifications, together with positive and negative control samples, were performed on Gene Amp PCR System 9700 (Applied Biosystem) and amplification products were separated on the ABI Prism 3100 Avant Genetic Analyzer (Applied Biosystems, Foster City, CA) and ABI Prism 3130 Genetic Analyzer (Applied Biosystems, Foster City, CA). Electrophoresis data was automatically analyzed using Genescan v.3.7 with Genotyper software and GeneMapper ID-X v. 1.1 (Applied Biosystems).

Back to Article Outline

3. Results and discussion 

The forensic usefulness of Mini-STRs and the significant improvements in terms of number of loci amplified with MiniFiler™ kit on degraded DNA compared to Identifiler® kit, is widely demonstrated [2]. Thus, new Mini-STR PCR-multiplexes were designed in order to obtain PCR products with length less than 120bp in size. Not all conventional STRs included in multiplex amplification kits can be reduced less than 120bp, but only those that are characterized by a limited number of repetitive units. Three of eight Mini-STRs (CSF1P0, D8S1179 and D13S317) described in this work, were previously validated and tested in singleplex on archival Bouin's fluid-fixed paraffin-embedded tissues by Turrina et al. [3]. Moreover these three markers are already included in the MiniFiler™ kit, but in this work the primer sizes were further reduced. The two new PCR-multiplexes were successfully employed in our degraded samples.

The comparison of typing results between the two new Mini-STRs and conventional STRs (AmpFlSTR Identifiler®, ABI) on a sample of 100 healthy donors showed no genotype differences with good balance between alleles, no double peaks due to +A/−A and stutter products higher less than 15% of the main peak; confirming that changes in the dimensions of the STRs do not influence the profile.

DNA extracted from archival Bouin's fluid-fixed paraffin-embedded tissue specimens showed a higher degree of degradation so that PCR amplification with Identifiler® kit produced only 3 of 15 STRs with the lowest molecular size (D8S1179, D19S433, D3S1358), plus amelogenin marker. Typing with MiniFiler™ kit and the two new Mini-STR quadruplex systems was successful for all STR loci yielded a complete profile.

The two new multiplexes could provide additional information on Bouin's fluid-fixed paraffin-embedded tissue samples. Considering all STR markers employed in this work a genetic profile of 14 STR markers was obtained (D8S1179, D3S1358 and D19S433 from Identifiler® kit, CSF1P0, FGA, D2S1338, D7S820, D13S317, D16S539, D18S51, and D21S11 from MiniFiler and TPOX, TH01 and D5S818 from new Mini-STR multiplexes performed in this work).

In conclusion, analysis using the present two Mini-STR PCR-multiplexes combined with commercial kits is clearly more effective for forensic applications and confirmed their usefulness in analyzing degraded DNA samples.

Back to Article Outline

Conflict of interest 

None.

Back to Article Outline

References 

  1. Butler JM, Shen Y, McCord BR. The development of reduced size STR amplicons as tools for analysis of degraded DNA. J. Forensic Sci. 2003;48(5):1054–1064
  2. Mulero JJ, Chang CW, Lagacé RE, Wang DY, Bas JL, McMahon TP, et al. Development and validation of the AmpFℓSTR® MiniFiler™ PCR Amplification Kit: a MiniSTR multiplex for the analysis of degraded and/or PCR inhibited DNA. J. Forensic Sci. 2008;53(4):838–852
  3. Turrina S, Atzei R, Filippini G, De Leo D. STR typing of archival Bouin's fluid-fixed paraffin-embedded tissue using new sensitive redesigned primers for three STR loci (CSF1P0, D8S1179 and D13S317). J. Forensic Leg. Med. 2008;15(1):27–31

PII: S1875-1768(09)00169-3

doi:10.1016/j.fsigss.2009.08.156

Forensic Science International: Genetics Supplement Series
Volume 2, Issue 1 , Pages 21-22, December 2009