Volume 1, Issue 1 , Pages 4-6, August 2008
Locked nucleic acids: Increased trace DNA amplification success with improved primers
Article Outline
- Abstract
- 1. Introduction
- 2. Materials and methods
- 3. Results and discussion
- 4. Conclusions
- Funding source
- Conflict of interest
- Acknowledgements
- References
- Copyright
Abstract
Locked nucleic acids (LNAs) are a conformationally restricted DNA analog, which can be incorporated into oligonucleotides to increase binding strength. To investigate if LNAs increase amplification success for trace DNA samples in a forensic context, primer sequences for four routinely used STR loci (FGA, D7S820, D13S317 and D18S51) have been altered to include LNA bases. The LNA modified primers display a broader tolerance to a range of reaction conditions compared to unmodified DNA primers, with higher Tms giving increased specificity. Increased peak heights, improved peak height ratios and decreased template requirements were seen with LNA primers. The increased amplification success of LNA primers, and broader range of optimal reaction conditions, suggest that using LNA primers for multiplex STR genotyping assays could be highly beneficial for trace DNA genotyping.
Keywords: Locked nucleic acids, Low-copy number, Multiplexing, Amplification
1. Introduction
Locked nucleic acids (LNAs) are a novel nucleic acid analog, and are a promising tool for increasing DNA amplification success. The incorporation of LNA nucleotides into real-time PCR probes and primers has been shown to decrease Ct values significantly [1], [2] and decrease minimum template requirements, with a corresponding increase in amplification efficiency [3]. The improvement in amplification success using LNA oligonucleotides suggests that they may also be beneficial for standard PCR. We have compared modified primers containing LNA bases with their standard DNA primer counterparts for amplification sensitivity and success at low template levels, and examined the multiplexing ability of each primer pair, to determine if the LNA modifications are suitable for PCR primers used in DNA STR profiling.
2. Materials and methods
2.1. Primer sequences
Primer sequences were obtained from [4]. LNA primers (Table 1) were designed by the Sigma Proligo Design service, in accordance with design rules suggested by Levin [3] and Latorra [5]. Primers were synthesised and HPLC purified by Sigma, with forward primers labelled with 5′ phosphoramidite fluorophores.
Table 1. Oligonucleotide primer sequences
| Primer name | DNA primer | LNA primer |
|---|---|---|
| FGA-F (6FAM) | aaataaaattaggcatatttacaagc | aaatAaaattAggcAtatttacaagc |
| FGA-R | gctgagtgatttgtctgtaattg | gctgagtgAtttgtctgtaattg |
| D7S820-F (TET) | gaacacttgtcatagtttagaacgaac | gaacActtgtcatAgtttagaacgaac |
| D7S820-R | tcattgacagaattgcacca | tcAttgAcagAattgcacca |
| D13S317-F (TET) | tctgacccatctaacgccta | tctgAcccAtctaacgccta |
| D13S317-R | cagacagaaagatagatagatgattga | cagacAgaaAgatAgatagatgattga |
| D18S51-F (HEX) | tgagtgacaaattgagacctt | tgagtgAcaAattgagacctt |
| D18S51-R | gtcttacaataacagttgctactatt | gtcttAcAataacagttgctactatt |
2.2. DNA samples
DNA was extracted using the QIAamp DNA Micro kit (Qiagen) in accordance with the manufacturer's instructions, and quantitated with the Quantifiler Human DNA Quantification System (Applied Biosystems) on a ABI Prism 7500 real-time PCR System (Applied Biosystems).
2.3. PCR amplifications and electrophoresis
Optimisation of PCR reactant concentrations temperatures was performed using a Taguchi factorial array design [6]. Amplifications were performed in 25
μL volumes, containing 1× FastStart PCR buffer (Roche), 200
μmol/L dNTPs (Roche) empirically adjusted MgCl2 and primer concentrations, and 1
U of Roche FastStart Taq Polymerase. Thermal cycling was performed in a GeneAmp 9700 (Applied Biosystems) with 95
°C for 10
min, 28 cycles of 94
°C for 1
min, annealing for 1
min, and 72
°C for 1
min, followed by 45
min at 60
°C. Annealing temperatures were determined empirically for each primer pair.
Samples were analysed with a ABI3100 Genetic Analyser, with Hi-Di formamide (Applied Biosystems) and GS400 size standard (Applied Biosystems). Default run parameters for the POP-4 36
cm fragment analysis module were used. Raw data were genotyped with GeneMapper ID v 3.01 (Applied Biosystems).
3. Results and discussion
3.1. Low copy number LNA amplifications
LNA increased amplification success for samples containing between 50 and 1000
pg of template DNA. Between these template limits, LNA primers showed an average increase in peak height of 30% compared to standard DNA primers, although variation was noted between the four loci (Table 2). At very low template levels, both the DNA and LNA amplifications were subject to considerable stochastic variation, preventing accurate comparisons between the two primer types. However, there were indications that LNA could improve trace profiling at some loci. Overall, the most successful LNA primer pair (D7S820) showed peak height increases of over 30% compared to the most successful DNA primers (D13S317). Even the least effective LNA primer was still 26% better than the least effective DNA primer (D7S820) for average peak heights. These findings suggest that a conventional DNA primer which is performing poorly can be significantly improved by careful incorporation of LNA bases. We applied the LNA design rules [3], [5] in a conservative manner to our LNA primers. Alternative primer designs may yield even better outcomes.
Table 2. Average peak height percentages for LNA primers, compared to DNA primers
| Template amount (pg) | Locus | ||||
|---|---|---|---|---|---|
| FGA | D7S820 | D13S317 | D18S51 | Average | |
| 1000 | 132 | 192 | 105 | 101 | 128 |
| 500 | 104 | 154 | 99 | 118 | 120 |
| 250 | 106 | 149 | 83 | 159 | 123 |
| 100 | 121 | 150 | 87 | 113 | 112 |
| 75 | 177 | 201 | 105 | 135 | 150 |
| 50 | 99 | 117 | 78 | 112 | 108 |
| 25 | 104 | 128 | 91 | 72 | 100 |
| 10 | 114 | 34 | 45 | 170 | 94 |
| 5 | 259 | – | 86 | – | 132 |
There was a slight increase in the number of artefacts in the LNA amplifications. Stutter was slightly elevated, but only by around 5%. At D18S51, the LNA bases appeared to inhibit non-template adenylation, with 80% of LNA products remaining unadenylated. However, peak height and peak area balance between alleles was increased by the use of LNA bases.
3.2. Multiplexing LNA primers
During the optimisation of the primer pairs, it was noted that the LNA primers had wider optimal ranges for annealing temperature, and MgCl2 and primer concentrations. These ranges proved beneficial for creating duplex amplifications with the LNA primers, with less adjustment of parameters required than for the DNA primers. LNA primers gave increased amplification success with the two duplexes, FGA/D18S51 (an increase of 23% in peak height), and D13S317/D7S820 (increase of 158%). However, the D13S317/D7S820 LNA duplex showed greatly increased stutter with the LNA primers only. This appeared to be caused by an interaction between the four primers, although none was predicted using multiplex primer software. The increase in stutter was not observed with the corresponding DNA duplex, suggesting that the LNA bases themselves were causing the interaction.
4. Conclusions
LNA offers a promising new tool for increasing amplification sensitivity and specificity. LNA amplifications showed higher peak heights compared to standard DNA amplifications, with greater success at template levels as low as 50
pg. Increased ease of reaction optimisation, for both single and multiplex reactions, also give LNA primers an advantage over standard DNA primers. It appears that the design of the LNA primers is crucial, and although published design rules can assist [3], empirical testing of each primer design is necessary. Overall, LNA could be beneficial in modifying existing PCR primers for the amplification of STR loci in current multiplex systems.
Funding source
Funding for this study was provided by the Australian Research Council and Victoria Police Forensic Services Department. The sponsors had no involvement of the paper or decisions related to the paper.
Conflict of interest
None.
Acknowledgements
The authors are grateful to the Australian Research Council and Victoria Police Forensic Services Department for providing funding for the study, and to the Sigma Proligo design team for invaluable help and advice.
References
- . Evaluation of probe chemistries and platforms to improve the detection limit of real-time PCR. J. Microbiol. Methods. 2006;66:206–216
- . Real-time genotyping with oligonucleotide probes containing locked nucleic acids. Anal. Biochem. 2004;324:143–152
- . Position-dependent effects of locked nucleic acid (LNA) on DNA sequencing and PCR primers. Nucleic Acids Res. 2006;34:e142
- . The development of reduced size STR amplicons as tools for analysis of degraded DNA. J. Forensic Sci. 2003;48:1054–1064
- . Design considerations and effects of LNA in PCR primers. Mol. Cell Probes. 2003;17:253–259
- . A simple procedure for optimising the polymerase chain reaction (PCR) using modified Taguchi methods. Nucleic Acids Res. 1994;22:3801–3805
PII: S1875-1768(08)00083-8
doi:10.1016/j.fsigss.2007.10.052
© 2008 Elsevier Ireland Ltd. All rights reserved.
Volume 1, Issue 1 , Pages 4-6, August 2008
